ClinVar Genomic variation as it relates to human health
NM_018006.5(TRMU):c.1073_1081dup (p.Gln358_Val360dup)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic(2); Likely pathogenic(2); Uncertain significance(4)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_018006.5(TRMU):c.1073_1081dup (p.Gln358_Val360dup)
Variation ID: 552491 Accession: VCV000552491.22
- Type and length
-
Duplication, 9 bp
- Location
-
Cytogenetic: 22q13.31 22: 46356036-46356037 (GRCh38) [ NCBI UCSC ] 22: 46751933-46751934 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Aug 5, 2018 Feb 14, 2024 Jan 6, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_018006.5:c.1073_1081dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_060476.2:p.Gln358_Val360dup inframe insertion NM_001282782.2:c.731_739dup NP_001269711.1:p.Gln244_Val246dup inframe insertion NM_001282783.2:c.653_661dup NP_001269712.1:p.Gln218_Val220dup inframe insertion NM_001282784.2:c.598+456_598+464dup intron variant NM_001282785.2:c.1018+456_1018+464dup intron variant NM_018006.4:c.1073_1081dupAGGCTGTGC NR_104240.2:n.1069_1077dup non-coding transcript variant NR_104241.2:n.962_970dup non-coding transcript variant NC_000022.11:g.46356044_46356052dup NC_000022.10:g.46751941_46751949dup NG_012173.1:g.25644_25652dup - Protein change
- Other names
- -
- Canonical SPDI
- NC_000022.11:46356036:GCTGTGCAGGCTGTGC:GCTGTGCAGGCTGTGCAGGCTGTGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
TRMU | - | - |
GRCh38 GRCh37 |
735 | 823 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Conflicting interpretations of pathogenicity (4) |
criteria provided, conflicting classifications
|
Sep 1, 2022 | RCV000667762.11 | |
Conflicting interpretations of pathogenicity (3) |
criteria provided, conflicting classifications
|
Jan 6, 2024 | RCV000734954.13 | |
Uncertain significance (1) |
criteria provided, single submitter
|
Jan 11, 2023 | RCV003117469.3 | |
Likely pathogenic (1) |
criteria provided, single submitter
|
Sep 5, 2023 | RCV003472090.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(Jun 20, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Acute infantile liver failure due to synthesis defect of mtDNA-encoded proteins
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV000792264.1
First in ClinVar: Aug 05, 2018 Last updated: Aug 05, 2018 |
|
|
Uncertain significance
(Aug 22, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000863135.1
First in ClinVar: Dec 16, 2018 Last updated: Dec 16, 2018 |
Sex: mixed
|
|
Pathogenic
(Jan 16, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Acute infantile liver failure due to synthesis defect of mtDNA-encoded proteins
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
germline
|
Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München
Accession: SCV001150302.1
First in ClinVar: Feb 03, 2020 Last updated: Feb 03, 2020 |
Sex: male
Tissue: blood
|
|
Likely pathogenic
(Apr 02, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV001786248.1
First in ClinVar: Aug 14, 2021 Last updated: Aug 14, 2021 |
Comment:
In-frame insertion of 3 amino acids in a non-repeat region; Not observed at a significant frequency in large population cohorts (Lek et al., 2016); This … (more)
In-frame insertion of 3 amino acids in a non-repeat region; Not observed at a significant frequency in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 21169334, 30369941, 21153446, 25407320, 27854233) (less)
|
|
Uncertain significance
(Sep 01, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Acute infantile liver failure due to synthesis defect of mtDNA-encoded proteins
Affected status: yes
Allele origin:
germline
|
MGZ Medical Genetics Center
Accession: SCV002581896.1
First in ClinVar: Oct 15, 2022 Last updated: Oct 15, 2022 |
Number of individuals with the variant: 2
Sex: female
|
|
Uncertain significance
(Jan 11, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV003801141.2
First in ClinVar: Feb 13, 2023 Last updated: Nov 11, 2023 |
Comment:
Variant summary: TRMU c.1073_1081dupAGGCTGTGC (p.Gln358_Val360dup) results in an in-frame duplication that is predicted to duplicate three amino acids into the encoded protein. The variant allele … (more)
Variant summary: TRMU c.1073_1081dupAGGCTGTGC (p.Gln358_Val360dup) results in an in-frame duplication that is predicted to duplicate three amino acids into the encoded protein. The variant allele was found at a frequency of 2e-05 in 251186 control chromosomes (gnomAD). c.1073_1081dupAGGCTGTGC has been reported in the literature in individuals affected with Leigh syndrome with liver failure (Theunissen_2018) and with defects in mitochondrial complexes I and IV (Schara_TRMU_JIMD_2010). These data indicate that the variant may be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Seven clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as VUS (n=3) and pathogenic /likely pathogenic (n=4). Based on the evidence outlined above, the variant was classified as VUS-possibly pathogenic. (less)
|
|
Likely pathogenic
(Sep 05, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Aminoglycoside-induced deafness
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004204362.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
Pathogenic
(Jan 06, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV001231171.5
First in ClinVar: Apr 15, 2020 Last updated: Feb 14, 2024 |
Comment:
This variant, c.1073_1081dup, results in the insertion of 3 amino acid(s) of the TRMU protein (p.Gln358_Val360dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.1073_1081dup, results in the insertion of 3 amino acid(s) of the TRMU protein (p.Gln358_Val360dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs753112330, gnomAD 0.008%). This variant has been observed in individual(s) with acute infantile liver failure (PMID: 21169334, 30369941, 33365252). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as c.1081_1082insAGGCTGTGC. ClinVar contains an entry for this variant (Variation ID: 552491). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Likely pathogenic
(Sep 15, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Acute infantile liver failure due to synthesis defect of mtDNA-encoded proteins
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002076163.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Leigh syndrome associated with TRMU gene mutations. | Sala-Coromina J | Molecular genetics and metabolism reports | 2020 | PMID: 33365252 |
Whole Exome Sequencing Is the Preferred Strategy to Identify the Genetic Defect in Patients With a Probable or Possible Mitochondrial Cause. | Theunissen TEJ | Frontiers in genetics | 2018 | PMID: 30369941 |
Nuclear factors involved in mitochondrial translation cause a subgroup of combined respiratory chain deficiency. | Kemp JP | Brain : a journal of neurology | 2011 | PMID: 21169334 |
Acute liver failure with subsequent cirrhosis as the primary manifestation of TRMU mutations. | Schara U | Journal of inherited metabolic disease | 2011 | PMID: 21153446 |
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=TRMU | - | - | - | - |
Text-mined citations for rs753112330 ...
HelpRecord last updated Apr 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.