RefSNP Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 36/130 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: C Clinical Association: unknown HGVS Names NM_000789.2:c.2787C>T NM_152830.1:c.1065C>T NT_010783.14:g.20220628C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss84149531 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs4348 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4737 DEBNICK|dcp1-17107 fwd/B C/T gatgtttaaggaggctgatgatttcttcac tccctggggctgctgcccgtgcctcctgag 05/03/99 12/23/03 36 Genomic unknown ss84149531 PHARMGKB_PARC|PS206642_PA151796960_16537 fwd/B C/T gatgtttaaggaggctgatgatttcttcac tccctggggctgctgcccgtgcctcctgag 12/06/07 12/10/07 130 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs4348|allelePos=76|totalLen=151|taxid=9606|snpclass=1|alleles='C/T'|mol=Genomic|build=130 GTTTGGGCAG AACTCCCTCT GCTTGCAGGG CTGGACGCCC AGGAGGATGT TTAAGGAGGC TGATGATTTC TTCAC Y TCCCTGGGGC TGCTGCCCGT GCCTCCTGAG TTCTGGAACA AGTCGATGCT GGAGAAGCCA ACCGACGGGC GGGAG   GeneView GeneView via analysis of contig annotation:   View more variation on this gene (click to hide). Include clinically associated: in gene region cSNP has frequency double hit Assembly SNP to Chr Chr Chr position Contig Contig position Allele Function mRNA Protein mRNA to Chr Accession Position Allele change Accession Position Residue change on assembly: is labeled at position on chromosome . GeneView via analysis of contig annotation: N/A. GeneView via direct blast against RefSeq sequences (used when no gene model is available): Function Chr mRNA Protein SNP to mRNA Accession Position Allele change Accession Position Residue change on assembly: is labeled at position on chromosome . GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A   Integrated Maps: Genome Build Chr Chr Pos Contig Contig Pos SNP to Chr Contig allele Group term Group label Contig label Neighbor SNP Map Method doesn't map to any assembly.   NCBI Resource Links Resource Submitter-Referenced GenBank AF118569 dbSNP Blast Analysis UniGene Cluster ID 298469 3D structure mapping NP_000780  NP_690043     Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP C T ss84149531 PA151796961 88 AF 0.977 0.023 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0.044+/-0.142 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .