| RefSNP | | Organism: | human (Homo sapiens) | | Molecule Type: | Genomic | | Created/Updated in build: | 36/130 | | Map to Genome Build: | 36.3 |
| | Allele | | Variation Class: | SNP:
single nucleotide polymorphism | | RefSNP Alleles: | A/T | | Ancestral Allele: | A | | Clinical Association: | unknown |
| | HGVS Names | | NM_001005852.2:c.-16+2971G>A | | NT_011875.11:g.7883149A>T |
| |
SNP Details are organized in the following sections:
The submission ss3949 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3912 during BLAST analysis for the current build.
NCBI
Assay ID | Handle|Submitter ID | Validation
Status | ss to rs
Orientation
/Strand | Alleles | 5' Near Seq 30 bp | 3' Near Seq 30 bp | Entry
Date | Update
Date | Build
Added | Molecule
Type | Freq
Warning | Ancestral
Allele | Success
Rate |
|---|
| ss3949 | OEFNER|M21 |  | fwd/T | A/T | atcttttgttttttgttcctcagactgtat | gtttcagttgacttagcttccagtttgttg | 01/23/99 | 12/23/03 | 36 | Genomic | | | unknown |
>gnl|dbSNP|rs3912|allelePos=357|totalLen=415|taxid=9606|snpclass=1|alleles='A/T'|mol=Genomic|build=36 cttttatttc tgactacagg gccctctttt gcattgtttt tgtaggtcag atttattagt
agtatgttct ttcagctttt gtgtatctgg gaatatttca g
tttctccttt attttgaagg atagtctttg agtttttcct acttaacaga tcctggagct
tcttggatgt gtaaattaat gattttcatc aaatgtgaag ttgttttcgg ctattctgca
gatatccttt accacccctt tgctgcctct tcctattgtg ggtaataggc atgtctctgt
atgttggaga gaatcaaagg tcttttaagc ccttgatttt tatttatctt ttgttttttg
ttcctcagac tgtat
W
gtttcagttg acttagcttc cagtttgttg attcttctgc ctgctcaaat ctgctgtt
GeneView via analysis of contig annotation:
View more variation on this gene (click to hide).
| Assembly |
SNP to Chr |
Chr |
Chr position |
Contig |
Contig position |
Allele |
| Function |
mRNA |
Protein |
| mRNA to Chr |
Accession |
Position |
Allele change |
Accession |
Position |
Residue change |
on assembly: is labeled at position on chromosome .
GeneView via analysis of contig annotation: N/A.
GeneView via direct blast against RefSeq sequences (used when no gene model is available):
| Function |
Chr |
mRNA |
Protein |
| SNP to mRNA |
Accession |
Position |
Allele change |
Accession |
Position |
Residue change |
on assembly: is labeled at position on chromosome .
GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A
doesn't map to any assembly.
| Submitter-Referenced |
|---|
| dbSTS | | G42835
|
| | | | | Resource
| | Sample Ascertainment | Genotypes | Alleles |
|---|
| ss# | Population | Individual
Group | Chrom.
Sample Cnt.
| Source | HWP | A
 | T
 |
|---|
| ss3949 | Global | | 718 | AF | | 0.999 | 0.001 | | | | | | | | | |
| Summary | Average
Het.+/- std err: | Individual
Count | Founders
Count | Individual
Overlap | Genotype
Conflict |
|---|
| 0.003+/-0.037 | 0 | 0 | 0 | 0 |
| Validation status | Marker displays
Mendelian segregation | PCR results confirmed
in multiple reactions | Homozygotes detected
in individual genotype data | | YES | YES | YES |
| 
