| RefSNP | | Organism: | human (Homo sapiens) | | Molecule Type: | Genomic | | Created/Updated in build: | 36/130 | | Map to Genome Build: | 36.3 | | Citation: | PubMed |
| | Allele | | Variation Class: | DIP: deletion/insertion polymorphism | | RefSNP Alleles: | -/G | | Ancestral Allele: | Not available | | Clinical Association: | unknown |
| | HGVS Names | | NM_001005852.2:c.-16+3800delG | | NT_011875.11:g.7883978delG |
| |
SNP Details are organized in the following sections:
The submission ss3945 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3908 during BLAST analysis for the current build.
NCBI Assay ID | Handle|Submitter ID | Validation Status | ss to rs Orientation /Strand | Alleles | 5' Near Seq 30 bp | 3' Near Seq 30 bp | Entry Date | Update Date | Build Added | Molecule Type | Freq Warning | Ancestral Allele | Success Rate |
|---|
| ss3945 | OEFNER|M17 |       | fwd/B | -/G | ccagagtttgtggttgctggttgttacggg | tttttttaagtgaattttggggtttgttaa | 01/23/99 | 04/07/04 | 36 | Genomic | | | unknown |
>gnl|dbSNP|rs3908|allelePos=68|totalLen=333|taxid=9606|snpclass=2|alleles='-/G'|mol=Genomic|build=36 CTGGTCATaa cactggaaat cagattctgt ctactcacca gagtttgtgg ttgctggttg
ttacggg
N
tttttttaag tgaattttgg ggtttgttaa gtggccaaac tatttttgtg aagactgttg
tatgtgggtt tcagatgtct ctacatcagt ttgtggtcag ctagtgagtt aaattttatg
aaaagcctgg agaaacaaga atagcagtaa aaacttccag tctttgtaga ttgggtgtct
tcagtgctta gctgggcaat ttaaaactta ccttaAGTAG TACAGTTGGC CCTTTGTGTC
TGT
GAGTTTCACA TTTGTAGGTT CA
GeneView via analysis of contig annotation:
View more variation on this gene (click to hide).
| Assembly |
SNP to Chr |
Chr |
Chr position |
Contig |
Contig position |
Allele |
| Function |
mRNA |
Protein |
| mRNA to Chr |
Accession |
Position |
Allele change |
Accession |
Position |
Residue change |
on assembly: is labeled at position on chromosome .
GeneView via analysis of contig annotation: N/A.
GeneView via direct blast against RefSeq sequences (used when no gene model is available):
| Function |
Chr |
mRNA |
Protein |
| SNP to mRNA |
Accession |
Position |
Allele change |
Accession |
Position |
Residue change |
on assembly: is labeled at position on chromosome .
GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A
doesn't map to any assembly.
| Submitter-Referenced | | dbSTS | | G42833
|
| | | | | Resource
| | Sample Ascertainment | Genotypes | Alleles | | ss# | Population | Individual Group | Chrom. Sample Cnt.
| Source | HWP | -
 | G
 |
|---|
| ss3945 | Global | | 718 | AF | | 0.050 | 0.950 | | | | | | | |   | |
| Summary | Average Het.+/- std err: | Individual Count | Founders Count | Individual Overlap | Genotype Conflict |
|---|
| 0.095+/-0.196 | 0 | 0 | 0 | 0 |
| Validation status | Marker displays Mendelian segregation | PCR results confirmed in multiple reactions | Homozygotes detected in individual genotype data |       | YES | YES | YES |
|