Introduction
Biological Sequences
Classes of Biological Sequences
Locations on Biological Sequences
Associating Annotation With Locations
On Biological Sequences
Collections of Related Biological Sequences
Consequences of the Data Model
The NCBI sequence databases and software tools are designed around a particular model of biological sequence data. It is designed to provide a few unifying concepts which cross a wide range of domains, providing a path between the domains. Specialized objects are defined which are appropriate within a domain. In the following sections we will present the unifying ideas, and then examine each area of the model in more detail.
Since we expect that computer technologies will continue to develop at a rapid rate, NCBI has made considerable investment of time and energy to ensure that our data and software tools are not too tightly bound to any particular computer platform or database technology. However, we also wish to embrace the intellectual rigor imposed by describing our data within a formal system and in a machine readable and checkable way. For this reason we have chosen to describe our data in Abstract Syntax Notation 1 (ASN.1; ISO 8824, 8825). Enough explanation will be given here to allow the reader to examine the data definitions. A much fuller description of ASN.1 and the NCBI software tools which use it appears in later chapters.
The data specification chapters are arranged by ASN.1 module with detailed discussions of data objects defined in each and the software functions available to operate on those objects. Each ASN.1 defined object has a matching "C" language structure. Each "C" structure has at a minimum, a function to create it, write it to an ASN.1 stream, read it from an ASN.1 stream, and destroy it. Many objects have additional functions. Some of these are described in the chapter on the module and some with more extensive interfaces are described in additional chapters. Each module chapter begins with a description of the elements, followed by the full ASN.1 definition of the module, then the "C" code header defining the structures.
This chapter provides an overview of all modules. Selected ASN.1 definitions are inserted into the body of the text as necessary. They are also described in the chapter on the appropriate module.
There are two major areas for which data objects have been defined. One is bibliographic data. It is clear that this class of information is central to all scientific fields within and outside of molecular biology so we expect these definitions to be widely useful. We have followed the American National Standard for Bibliographic References (ANSI Z39.29-1977) and consulted with the US Patent Office and professional librarians to ensure complete and accurate representation of citation information. Unlike biological data, this data is relatively well understood, so we hope that the bibliographic specification can be quite complete and stable. Despite its importance, the bibliographic specification will not be discussed further here, since it does not present ideas which may be novel to the reader.
The other major area of the specification is biological sequence data and its associated information. Here the data model attempts to achieve a number of goals. Biomedical information is a vast interconnected web of data which crosses many domains of discourse with very different ways of viewing the world. Biological science is very much like the parable of the blind men and elephant. To some of the blind men the elephant feels like a column, to some like a snake, to others like a wall. The excitement of modern biological research is that we all agree that, at least at some level, we are all exploring aspects of the same thing. But it is early enough in the development of the science that we cannot agree on what that thing is.
The power of molecular biology is that DNA and protein sequence data cut across most fields of biology from evolution to development, from enzymology to agriculture, from statistical mechanics to medicine. Sequence data can be viewed as a simple, relatively well defined armature on which data from various disciplines can be hung. By associating diverse data with the sequence, connections can be made between fields of research with no other common ground, and often with little or no idea of what the other field is doing.
This data model establishes a biological sequence as a simple integer coordinate system with which diverse data can be associated. It is reasonable to hope that such a simple core can be very stable and compatible with a very wide range of data. Additional information closely linked to the coordinate system, such as the sequence of amino acids or bases, or genes on a genetic map are layered onto it. With stable identifiers for specific coordinate systems, a greater diversity of information about the coordinate system can be specifically attached to it in a very flexible yet rigorous way. The essential differences between different biological forms are preserved, yet they can viewed as aspects of the same thing around the core, and thus move us toward our goal of understanding the totality.
A Bioseq is a single continuous biological sequence. It can be nucleic acid or protein. It can be fully instantiated (i.e. we have data for every residue) or only partially instantiated (e.g. we know a fragment is 10 kilobases long, but we only have sequence data over 1 kilobase). A Bioseq is defined in ASN.1 as follows:
Bioseq ::= SEQUENCE {
id SET OF Seq-id OPTIONAL,
descr Seq-descr ,
inst Seq-inst ,
annot SET OF Seq-annot OPTIONAL }
In ASN.1 a named datatype begins with a capital letter (e.g. Bioseq). The symbol "::=" means "is defined as". A primitive type is all capitals (e.g. SEQUENCE). A field within a named datatype begins with a lower case letter (e.g. descr). A structured datatype is bounded by curly brackets ({}). We can now read the definition above: a Bioseq is defined as a SEQUENCE (i.e. a structure where the elements must come in order; the mathematical notion of SEQUENCE, not the biological one). The first element of Bioseq is called "id" and is a SET OF (i.e. an unordered collection of repeating elements of the same type) a named datatype called "Seq-id". Seq-id would have its own definition elsewhere. The second element is called "descr" and is a named type called "Seq-descr", which is OPTIONAL. In this text, when we wish to refer to the id element of the named type Bioseq, we will use the notation "Bioseq.id".
A Bioseq has two OPTIONAL elements, which both have descriptive information ABOUT the sequence. Seq-descr is a collection of types of information about the context of the sequence. It may set biological context (e.g. define the organism sequenced), or bibliographic context (e.g. the paper it was published in), among other things. Seq-annot is information that is explicitly tied to locations on the sequence. This could be feature tables, alignments, or graphs, at the present time. A Bioseq can have more than one feature table, perhaps coming from different sources, or a feature table and a graph, etc.
A Bioseq is only REQUIRED to have two elements, id and inst. Bioseq.id is one or more identifiers for this Bioseq. An identifier is a key which allows us to retrieve this object from a database or identify it uniquely. It is not a name, which is a human compatible description, but not necessarily a unique identifier. The name "Jane Doe" does not uniquely identify a person in the United States, while the identifier, social security number, does. Each Seq-id is a CHOICE of one of a number of identifier types from different databases, which may have different structures. All Bioseqs MUST have at least one identifier.
The other required element of a Bioseq is a Seq-inst. This element instantiates the sequence itself. It represents things like is it DNA, RNA, or protein? Circular or linear? Double-stranded or single-stranded? How long is it?
Seq-inst ::= SEQUENCE {
repr ENUMERATED {
not-set (0) ,
virtual (1) ,
raw (2) ,
seg (3) ,
const (4) ,
ref (5) ,
consen (6) ,
map (7) ,
other (255) } ,
mol ENUMERATED {
not-set (0) ,
dna (1) ,
rna (2) ,
aa (3) ,
na (4) ,
other (255) } ,
length INTEGER OPTIONAL ,
fuzz Int-fuzz OPTIONAL ,
topology ENUMERATED {
not-set (0) ,
linear (1) ,
circular (2) ,
tandem (3) ,
other (255) } DEFAULT linear ,
strand ENUMERATED {
not-set (0) ,
ss (1) ,
ds (2) ,
mixed (3) ,
other (255) } OPTIONAL ,
seq-data Seq-data OPTIONAL ,
ext Seq-ext OPTIONAL ,
hist Seq-hist OPTIONAL }
Seq-inst is the parent class of a sequence representation class hierarchy. There are two major branches to the hierarchy. The molecule type branch is indicted by Seq-inst.mol. This could be a nucleic acid, or further sub classified as RNA or DNA. The nucleic acid may be circular, linear, or one repeat of a tandem repeat structure. It can be double, single, or of a mixed strandedness. It could also be a protein, in which case topology and strandedness are not relevant.
There is also a representation branch, which is independent of the molecule type branch. This class hierarchy involves the particular data structure used to represent the knowledge we have about the molecule, no matter which part of the molecule type branch it may be in. The repr element indicates the type of representation used. The aim of such a set of representation classes is to support the information to express different views of sequence based objects, from chromosomes to restriction fragments, from genetic maps to proteins, within a single overall model. The ability to do this confers profound advantages for software tools, data storage and retrieval, and traversal of related sequence and map data from different scientific domains.

A virtual representation is used to describe a sequence about which we may know things like it is DNA, it is double stranded, we may even know it's length, but we do not have the actual sequence itself yet. Most fields of the Seq-inst are filled in, but Seq-inst.seq-data is empty. An example would be a band on a restriction map.
A raw representation is used for what we traditionally consider a sequence. We know it is DNA, it is double stranded, we know its length exactly, and we have the sequence data itself. In this case, Seq-inst.seq-data contains the sequence data.
A segmented representation is very analogous to a virtual representation. We posit that a continuous double stranded DNA sequence of a certain length exists, and pieces of it exist in other Bioseqs, but there is no data in Seq-inst.seq-data. Such a case would be when we have cloned and mapped a DNA fragment containing a large protein coding region, but have only actually sequenced the regions immediately around the exons. The sequence of each exon is an individual raw Bioseq in its own right. The regions between exons are virtual Bioseqs. The segmented Bioseq uses Seq-inst.ext to hold a SEQUENCE OF Seq-loc. That is, the extension is an ordered series of locations on OTHER Bioseqs, in this case the raw and virtual Bioseqs representing the exons and introns. The segmented Bioseq contains data only by reference to other Bioseqs. In order to retrieve the base at the first position in the segmented Bioseq, one would go to the first Seq-loc in the extension, and return the appropriate base from the Bioseq it points to.
A constructed Bioseq is used to describe an assembly or merge of other Bioseqs. It is analogous to the raw representation. In fact, most raw Bioseqs were actually constructed from an assembly of gel readings. However, the constructed representation class is really meant for tracking higher level merging, such as when an expert in a particular organism or gene region may construct a "typical" sequence from that region by merging available sequence data, often published by different groups, using domain knowledge to resolve discrepancies between reports or to select a typical allele. Seq-inst contains an optional Seq-hist object. Seq-hist contains a field called "assembly" which is a SET OF Seq-align, or sequence alignments. The alignments are used to record the history of how the various component Bioseqs used for the merge are related to the final product. A constructed sequence DOES contain sequence data in Seq-inst.seq-data, unlike a segmented sequence, because the component sequences may overlap, or expert knowledge may have been used to determine the "correct" residue at any position that is not captured in the original components. So Seq-hist.assembly is used to simply record the relationship of the merge to the old Bioseqs, but does NOT describe how to generate it from them.
A map is akin to a virtual Bioseq. For example, for a genetic map of E.coli, we might posit that the E.coli chromosome is about 5 million base pairs long, DNA, double stranded, circular, but we do not have the sequence data for it. However, we do know the positions of some genes on this putative sequence. In this case, the Seq-inst.ext is a SEQUENCE OF Seq-feat, that is, a feature table. For a genetic map, the feature table contains Gene-ref features. An ordered restriction map would have a feature table containing Rsite-ref features. The feature table is part of Seq-inst because, for a map, it is an essential part of instantiating the map Bioseq, not merely annotation on a known sequence. In a sense, for a map, the annotation IS part of the sequence. As an aside, note that we have given gene positions on the E.coli genetic map in base pairs, while the standard E.coli map is numbered from 0.0 to 100.0 map units. Numbering systems can be applied to a Bioseq as a descriptor or a feature. For E.coli, we would simply apply the 0.0 - 100.0 floating point numbering system to the map Bioseq. Gene positions can then be shown to the scientists in familiar map units, while the underlying software still treats positions as large integers, just the same as with any other Bioseq.
Coordinates on ANY class of Bioseq are ALWAYS integer offsets. So the first residue in any Bioseq is at position 0. The last residue of any Bioseq is in position (length - 1).
The consequence of this design is that one uses EXACTLY the same data object to describe the location of a gene on an unsequenced restriction fragment, a fully sequenced piece of DNA, a partially sequenced piece of DNA, a putative overview of a large genetic region, or a genetic or physical map. Software to display, manipulate, or compare gene locations can work without change on the full range of possible representations. Sequence and physical map data can be easily integrated into a single, dynamically assembled view by creating a segmented sequence which points alternatively to raw or constructed Bioseqs and parts of a map Bioseq. The relationship between a genetic and physical map is simply an alignment between two Bioseqs of representation class map, no different than the alignment between two sequences of class raw generated by a database search program like BLAST or FASTA.
A Seq-loc is an object which defines a location on a Bioseq. The smooth class hierarchy for Seq-inst makes it possible to use the same Seq-loc to describe an interval on a genetic map as that used to describe an interval on a sequenced molecule.
Seq-loc is itself a class hierarchy. A valid Seq-loc can be an interval, a point, a whole sequence, a series of intervals, and so on.
Seq-loc ::= CHOICE {
null NULL ,
empty Seq-id ,
whole Seq-id ,
int Seq-interval ,
packed-int Packed-seqint ,
pnt Seq-point ,
packed-pnt Packed-seqpnt ,
mix Seq-loc-mix ,
equiv Seq-loc-equiv ,
bond Seq-bond ,
feat Feat-id }
Seq-loc.null indicates a region of unknown length for which no data exists. Such a location may be used in a segmented sequence for the region between two sequenced fragments about which nothing, not even length, is known.
All other Seq-loc types, except Seq-loc.feat, contain a Seq-id. This means they are independent of context. This means that data objects describing information ABOUT Bioseqs can be created and exchanged independently from the Bioseq itself. This encourages the development and exchange of structured knowledge about sequence data from many directions and is an essential goal of the data model.
Seq-annot, or sequence annotation, is a collection of information ABOUT a sequence, tied to specific regions of Bioseqs through the use of Seq-loc's. A Bioseq can have many Seq-annot's associated with it. This allows knowledge from a variety of sources to be collected in a single place but still be attributed to the original sources. Currently there are three kinds of Seq-annot, feature tables, alignments, and graphs.
A feature table is a collection of Seq-feat, or sequence features. A Seq-feat is designed to tie a Seq-loc together with a datablock, a block of specific data. Datablocks are defined objects themselves, many of which are objects used in their own right in some other context, such as publications (Pub) or references to organisms (Org-ref) or genes (Gene-ref). Some datablocks, such as coding regions (CdRegion) make sense only in the context of a Seq-loc. However, since by design there is no intention that one datablock need to have anything in common with any other datablock, each can be tailored exactly to do a particular job. If a change or addition is required to one datablock, no others are affected. In those cases where a pre-existing object from another context is used as a datablock, any software that can use that object can now operate on the feature as well. For example, a piece of code to display a publication can operate on a publication from a bibliographic database or one use as a sequence feature with no change.
Since the Seq-feat data structure itself and the Seq-loc used to attach it to the sequence are common to all features, it is also possible to support a class of operations over all features without regard to the different types of datablocks attached to them. So a function to determine all features in a particular region of a Bioseq need not care what type of features they are.

A Seq-feat is bipolar in that it contains up to two Seq-loc's. Seq-feat.location indicates the "source" and is the location similar to the single location in common feature table implementations. Seq-feat.product is the "sink". A CdRegion feature would have its Seq-feat.location on the DNA and it's Seq-feat.product on the protein sequence produced. Used this way it defines the process of translating a DNA sequence to a protein sequence. This establishes in an explicit way the important relationship between nucleic acid and protein sequence databases.
The presence of two Seq-loc's also allows a more complete representation of data conflicts or exceptional biological circumstances. If an author presents a DNA sequence and its protein product in a figure in a paper, it is possible to enter the DNA and protein sequences independently, and then confirm through the CdRegion feature that the DNA in fact translates to that protein sequence. In an unfortunate number of published papers, the DNA presented does not translate to the protein presented. This may be a signal that the database has made an error of some sort, which can be caught early and corrected. Or the original paper may be in error. In this case, the "conflict" flag can be set in CdRegion, but the protein sequence is not lost, and retroactive work can be done to determine the source of the problem. It may also be the case that a genomic sequence cannot be translated to a protein for a known biological reason, such as RNA editing or suppressor tRNAs. In this case the "exception" flag can be set in Seq-feat to indicate that the data are correct, but will not behave in the expected way.
A sequence alignment is essentially a correlation between Seq-locs, often associated with some score. An alignment is most commonly between two sequences, but it may be among many at once. In an alignment between two raw Bioseqs, a certain amount of optimization can be done in the data structure based on the knowledge that there is a one to one mapping between the residues of the sequences. So instead of recording the start and stop in Bioseq A and the start and stop in Bioseq B, it is enough to record the start in A and the start in B and the length of the aligned region. However if one is aligning a genetic map Bioseq with a physical map Bioseq, then one will wish to allow the aligned regions to distort relative one another to account for the differences from the different mapping techniques. To accommodate this most general case, there is a Seq-align type which is purely correlations between Seq-locs of any type, with no constraint that they cover exactly the same number of residues.
A Seq-align is considered to be a SEQUENCE OF segments. Each segment is an unbroken interval on a defined Bioseq, or a gap in that Bioseq. For example, let us look at the following three dimensional alignment with 6 segments:
Seq-ids
id=100 AAGGCCTTTTAGAGATGATGATGATGATGA
id=200 AAGGCCTaTTAG.......GATGATGATGA
id=300 ....CCTTTTAGAGATGATGAT....ATGA
| 1 | 2 | 3 | 4| 5 | 6 | Segments

The example above is a global alignment that is each segment sequentially maps a region of each Bioseq to a region of the others. An alignment can also be of type "diags", which is just a collection of segments with no implication about the logic of joining one segment to the next. This is equivalent to the diagonal lines that are shown on a dot-matrix plot.
The example above illustrates the most general form of a Seq-align, Std-seg, where each segment is purely a correlated set of Seq-loc. Two other forms of Seq-align allow denser packing of data for when only raw Bioseqs are aligned. These are Dense-seg, for global alignments, and Dense-diag for "diag" collections. The basic underlying model for these denser types is very similar to that shown above, but the data structure itself is somewhat different.
The third annotation type is a graph on a sequence, Seq-graph. It is basically a Seq-loc, over which to apply the graph, and a series of numbers representing values of the graph along the sequence. A software tool which calculates base composition or hydrophobic tendency might generate a Seq-graph. Additional fields in Seq-graph allow specification of axis labels, setting of ranges covered, compression of the data relative to the sequence, and so on.
It is often useful, even "natural", to package a group of sequences together. Some examples are a segmented Bioseq and the Bioseqs that make up its parts, a DNA sequence and its translated proteins, the separate chains of a multi-chain molecule, and so on. A Bioseq-set is such a collection of Bioseqs.
Bioseq-set ::= SEQUENCE {
id Object-id OPTIONAL ,
coll Dbtag OPTIONAL ,
level INTEGER OPTIONAL ,
class ENUMERATED {
not-set (0) ,
nuc-prot (1) ,
segset (2) ,
conset (3) ,
parts (4) ,
gibb (5) ,
gi (6) ,
genbank (7) ,
pir (8) ,
pub-set (9) ,
equiv (10) ,
swissprot (11) ,
pdb-entry (12) ,
other (255) } DEFAULT not-set ,
release VisibleString OPTIONAL ,
date Date OPTIONAL ,
descr Seq-descr OPTIONAL ,
seq-set SEQUENCE OF Seq-entry ,
annot SET OF Seq-annot OPTIONAL }
The basic structure of a Bioseq-set is very similar to that of a Bioseq. Instead of Bioseq.id, there is a series of identifier and descriptive fields for the set. A Bioseq-set is only a convenient way of packaging sequences so controlled, stable identifiers are less important for them than they are for Bioseqs. After the first few fields the structure is exactly parallel to a Bioseq.
There are descriptors which describe aspects of the collection and the Bioseqs within the collection. The general rule for descriptors in a Bioseq-set is that they apply to "all of everything below". That is, a Bioseq-set of human sequences need have only one Org-ref descriptor for "human" at the top level of the set, and it is applied to all Bioseqs within the set.
Then follows the equivalent of Seq-inst, that is the instantiation of the data. In this case, the data is the chain of contained Bioseqs or Bioseq-sets. A Seq-entry is either a Bioseq or Bioseq-set. Seq-entry's are very often used as arguments to display and analysis functions, since one can move around either a single Bioseq or a collection of related Bioseqs in context just as easily. This also makes a Bioseq-set recursive. That is, it may consist of collections of collections.
Seq-entry ::= CHOICE {
seq Bioseq ,
set Bioseq-set }
Finally, a Bioseq-set may contain Seq-annot's. Generally one would put the Seq-annot's which apply to more than one Bioseq in the Bioseq-set at this level. Examples would be CdRegion features that point to DNA and protein Bioseqs, or Seq-align which align more than one Bioseq with each other. However, since Seq-annot's always explicitly cite a Seq-id, it does not matter, in terms of meaning; at what level they are put. This is in contrast to descriptors, where context does matter.
This data model has profound consequences for building sequence databases and for researchers and software tools interacting with them. Assuming that Seq-ids point to stable coordinate systems, it is easily possible to consider the whole set of data conforming to the model as a distributed, active heterogeneous database. For example, let us suppose that two raw Bioseqs with Seq-ids "A" and "B" are published in the scientific literature and appear in the large public sequence databases. They are both genomic nucleic acid sequences from human, each coding for a single protein.
One researcher is a specialist in transcription initiation. He finds additional experimental information involving detailed work on initiation for the flanking region of Bioseq "A". He can then submit a feature table with a TxInit feature in it to the database with his summarized data. He need not contact the original author of "A", nor edit the original sequence entry for "A" to do this. The database staff, who is not experts in transcription initiation, need not attempt to annotate every transcription initiation paper in sufficient detail and accuracy to be of interest to a specialist in the area. The researcher submitting the feature need not use any particular software system or computer to participate, he need only submit a ASN.1 message which conforms to the specification for a feature.
Another researcher is a medical geneticist who is interested in the medical consequences of mutations in the gene on Bioseq "B". This individual can add annotation to "B" which is totally different in content to that added by the transcription specialist (in fact, it is unlikely that either follows the literature read by the other) and submit the data to the database in precisely the same way.
A third group may be doing bulk sequencing in the region of the human chromosome where "A" and "B" lie. They produce a third sequence, "C", which they discover by sequence similarity and mapping data, overlaps "A" at one end and "B" at the other. This group can submit not just the sequence of "C" but its relationship to "A" and "B" to the database and as part of their publication.
The database now has the information from five different research groups, experts in different fields, using different computer and software systems, and unaware, in many cases, of each other's work, to unambiguously pull together all this related information into an integrated high level view through the use of the shared data model and the controlled Seq-ids on common cited coordinate systems. This integration across disciplines and generation of high level views of the data is continuously and automatically available to all users and can be updated immediately on the arrival of new data without human intervention or interpretation by the database staff. This moves scientific databases from the role of curators of scientific data to the role of facilitators of discourse among researchers. It makes identification of potentially fruitful connections across disciplines an automatic result of data entry, rather than of painstaking analysis by a central group. It takes advantage of the growing rush of molecular biology data, making its volume and diversity advantages rather than liabilities.