1	RNA Resources Donna Messersmith, Ph.D. Scientist and President Labs-Now LLC (Learn About Biomedical Science-Now) dmessersmith@labs-now.com www.labs-now.com
2	Introduction In general, two classes of RNAs can be distinguished: Coding (Informational) RNAs Non-coding (Functional) RNAs
3	Types of RNAs Coding RNAs are derived from the transcription of DNA into messenger RNA (mRNAs) which encodes sequence information to be translated into a protein. They also exist in the form of viral genomes encoded as vRNA. Non-coding RNAs act purely at the level of the RNA and can carry out a number of varied functions in the cell. RNA is generally a single-stranded molecule that can form a much greater variety of complex three-dimensional molecular shapes than double-stranded DNA. Therefore, it can perform a greater variety of functions.
4	A warming-up exercise: RNAs in Entrez Using the NCBI Entrez databases, find RNA sequences and structures in Entrez. For example: Entrez Nucleotides: "mitochondrial myopathy" AND "biomol mrna"[prop] "biomol rrna"[prop] and use the Limits page to restrict the search to RefSeq Entrez Structure: tRNA AND 1[RNAChainCount]
5	User Questions - a few examples The exercises page of this course provides easy access to all of the user questions (and corresponding strategy files) that are integrated in this module. We will go through a number of the user questions in this course. Because of time limitations, we will not be able to cover all of them, but they are available on the course web site for your use at any time. The complete set of course exercises serves as a knowledge base of information for library-based bioinformatics support staff to facilitate your work with end-users.
6	User Question: Retrieving RNA sequences User Question: Retrieve sequence records for various RNA molecule types Retrieve snoRNA and scRNA sequence records for Homo sapiens. Answer
7	Objectives The learning target of this module is to: understand the diversity of the "RNA World": the many types and functions of RNA. identify questions currently being asked by the scientific community. locate RNA analysis resources (tools and databases) that can compliment experimental studies.
8	Contents Coding RNAs mRNA vRNA Non-coding RNAs Transfer-RNA (tRNA) Ribosomal-RNA (rRNA) Other Types of RNAs snRNA, snoRNA, gRNA; SRP riboswitches, aptamers, & ribozymes RNA-mediated interference (RNAi, miRNA) RNA Modification RNA Structural Analysis Further information on RNA resources
9	Coding RNAs Messenger RNA (mRNA) Viral RNA (vRNA)
10	Coding RNAs: Messenger RNA (mRNA) mRNA Sequence Analysis: Expression Analysis: Identifying transcripts that are expressed by sequence identification, degradation mechanisms/time-scales. Post-transcriptional Processing: Determination of splice sites (differential splicing), nucleotide modifications (mRNA 5' capping and 3' polyadenylation, ribose or base alterations), nuclear export mechanisms. Coding Frame information: Identification of codon bias profiles, potential frame-shift regions. Experimental Determination Methods: SAGE tags, microarray sequences to identify expressed genes Nuclease digestion patterns, RT-PCR, TLC, HPLC, MS/MS to identify sequence and modifications Some computational prediction/analysis projects: RNA/Database similarity searches to identify transcripts RNA/Genome alignments to determine intron/exon organization Prediction of coding regions (CDS) and potential products Identification of codon bias profiles
11	Coding RNAs: RNA Viruses (see module "Non-human Genomes" for searching viral genomes) (+) ssRNA Coxsackie Foot and Mouth Disease Polioviruses Rhinoviruses Rubella Yellow fever West Nile virus Equine encephalitis Hepatitis A and C Tobacco mosaic virus dsRNA Reovirus Rotovirus Leishmania virus More information at: http://www.virology.net/ http://www.cdc.gov/ (-) ssRNA viruses Measles Mumps Rabies Ebola Respiratory Syncytial Virus Parainfluenza Virus Influenza Retroviruses Rous sarcoma virus, Avian Myeloblastosis virus (AMV) Moloney murine leukemia virus (MMLV) Feline Leukemia virus HIV HTLV
12	Coding RNAs: Viral RNA (vRNA) vRNA Sequence Analysis RNA viruses are far more susceptible to genetic variation than DNA viruses, often resulting in important consequences for pathogenicity and immunogenicity. Mutation: RNA polymerases are at least 1000-10000 times more prone to error than DNA polymerases. This is responsible for the far higher mutation rates for RNA viruses. Recombination: Recombination may occur where there is dual infection with similar viruses of different strains. Reassortment: Where the virus genome consists of multiple discontinuous distinct pieces of RNA as in the case of influenza and rotaviruses. Reassortment of the individual pieces of RNA may occur in a dual infection leading to the production of new genotypes. Rearrangement: Gene rearrangement is seen in chronic rotavirus infection in children with immunodeficient syndromes. The rearranged genes may consist of a translated region and an untranslated duplicated region. Therefore these viruses have additional nucleotides in their sequence. In one case, a novel protein has been identified in one such isolate. The biological properties of this virus was also different. Resources: NCBI Viral Genomes – sequence information and analysis tools for all viruses and viroids whose complete genome sequences have been deposited into GeneBank, EMBL, or DDBJ NCBI Influenza Virus Sequence Database – browsing and sequence and genome retrieving, multiple sequence alignments and tree building HIV Sequence Database – HIV and related SIV sequence information, tools, and sequences NAR Viral genome databases
13	Non-coding RNAs Transfer RNA (tRNA) Ribosomal RNA (rRNA) Other types of RNAs
14	Types of non-coding RNAs Examples of non-coding RNAs include: Transfer RNA (tRNA) – Adaptor molecules that bring amino acids to the mRNA/ribosome complex. Ribosomal RNAs (rRNAs) – Structural and catalytic components of ribosomes, which are composed of several types of rRNA and about 100 different proteins. Transfer-Messenger RNAs (tmRNAs) – Performs a dual task in bacterial protein translation in adding a degradation signal peptide to the end of undesirable or damaged gene products. Internal Ribosome Entry Site (IRES) – a RNA sequence which allows internal entry of the 40S ribosomal subunit upstream of the translation initiation codon on mRNAs Small RNAs Small Nuclear RNAs (snRNA) – components of the spliceosome Small Nucleolar RNA (snoRNA) – modify rRNAs Guide RNA (gRNA) – involved in RNA editing processes within the mitochondria of kinetoplastid organisms Small cytosolic RNAs (scRNAs) – involved in RNA and protein trafficking microRNA and RNAis – Genomically-encoded or synthetic short RNA sequences, respectively, that regulate gene expression at the transcriptional or translational level. Riboswitches and Aptamers – Regions of mRNAs or independent RNA molecules, respectively, that can bind to an activator and then modulate gene expression or protein function. Ribozymes – Catalytic RNAs that can selectively bind to a substrate and catalyze a large and increasing number of reactions. NONCODE – database of non-coding RNAs RNA is generally a single-stranded molecule that can form a much greater variety of complex three-dimensional molecular shapes than double-stranded DNA. Therefore, it can perform a greater variety of functions.
15	Non-coding RNAs: Transfer RNA (tRNA)
16	Non-coding RNAs: Transfer RNA (tRNA) Sequence Databases: tRNA Compilation 2000 - A compilation of tRNA sequences and sequences of tRNA genes. Access to the database via the tRNA database searching engine at the very bottom of the page. You will have to select a Kingdom (or Organism) AND an AA before clicking Search!. Multiple selections are possible. GtRDB - The Genomic tRNA Database. Organelle-Specific Sequence Databases: (Animal mitochondrial genomes encode 22 tRNAs. Chloroplast genomes encode 32 tRNAs.) Compilation of mammaliam mitochondrial tRNA genes Organelle Genome Resources at NCBI (see module "Non-human Genomes") GOBASE - The Organelle Genome Database. MITOMAP - A human mitochondrial genome database. Gene Prediction Program: tRNAscan-SE - tRNA detection in large-scale genome sequences
17	Non-coding RNAs: Ribosomal RNA (rRNA)
18	Non-coding RNAs: Ribosomal RNA (rRNA)
19	Non-coding RNAs: rRNA (con't.) Sequence Databases: European Ribosomal RNA Database - Alignment of small and large subunit ribosomal RNA sequences with or without secondary structure information. European Large Subunit Ribosomal RNA Database European Small Subunit Ribosomal RNA Database Links to Primers, Secondary structure models, Variability maps, Trees and Software information. 5S Ribosomal RNA Database Prokaryotic 16S rRNA Signature Database Ribosomal Database Project (RDP-II) – rRNA sequence data, alignments, and phylogenies. 16S and 23S Ribosomal RNA Mutation Database Organelle-Specific Sequence Databases: (Animal mitochondrial genomes encode 2 rRNAs. Chloroplast genomes encode 3 to 4 rRNAs.) Organelle Genome Resources at NCBI (see module "Non-human Genomes") GOBASE - The Organelle Genome Database. Other databases: Database of ribosomal crosslinks
20	Some Other Types of RNAs tmRNA – Dual tRNA-like and mRNA-like nature (also known as 10Sa RNA or SsrA). The tmRNA Website – tmRNA sequences, foldings, and alignments. tmRDB – tmRNA (10Sa RNA) sequences and alignments. IRES – cis-acting RNA sequences which mediate internal entry of the 40S ribosomal subunit upstream of the translation initiation codon on eukaryotic and viral mRNAs IRESdb – the Internal Ribosome Entry Site database IRESite – searchable database of experimentally verified IRES structures
21	Some Other Types of non-coding RNAs Small RNAs snRNA (Small Nuclear RNA) – Assist in the splicing reaction. ncRNA list of snRNA snoRNA (Small Nucleolar RNA) – Assist in processing rRNAs and assembling ribosome subunits. Methylation Guide snoRNA Database Yeast snoRNA Database – Yeast small nucleolar RNAs. plant snoRNA database snoRNAbase: human H/ACA and C/D box snoRNA database gRNA (Guide RNA) – Involved in RNA editing processes within the mitochondria of kinetoplastid organisms. gRNAs db signal recognition particle (SRP) – a complex comprised of RNA and protein which is recognizes and transports specific proteins to the ER (eukaryotes) or plasma membrane (prokaryotes). Signal Recognition Particle Database (SRPDB)
22	Non-coding RNA: Riboswitches Aptamers Ribozymes
23	Non-coding RNAs: Riboswitches Riboswitches: Part of an mRNA molecule that can directly bind a small target molecule which can then affect the expression of that message. Metabolic biosensors and regulators of gene product expression. THI - Thiamin pyrophosphate regulates thiamin biosynthesis and transport B12 - Adenocylcobalamin regulates vitamin B12 biosynthesis and transport S-box - s-Adenosyl methionine regulates methionine biosynthesis and transport L-box - Lysine regulates lysine biosynthesis, catabolism and transport gcvT - Glycine regulates glycine biosynthesis, catabolism and transport
24	Non-coding RNAs: Aptamers Aptamers: An engineered RNA, DNA or protein molecule that can bind to specific molecular targets, such as a metabolite or receptor. Produced via through a combinatorial approach known as Systematic Evolution of Ligands by EXponential Enrichment (SELEX). RNA Biosensors: Acetylcholine basic-Fibroblast Growth Factor Theophylline vs. Caffeine Flavin mononucleotide Hoeschst 33528 Potentially useful as Therapeutic RNA Agents: anti-Thrombin anticoagulant anti-VEGF in treatment of Macular Degeneration anti-TGFbeta2 in treatment of Glaucoma anti-Kerotinocyte Growth Factor in treatment of Psoriasis anti-PDGF in treatment of Diabetic Retinopathy Aptamer Database
25	Non-coding RNAs: Ribozymes Native Ribozymes and the Key Component of RNA-Protein Complexes: Tetrahymena ribozyme Hammerhead ribozyme Hepatitis Delta virus Ribosome RNase P – RNase P Database Splicing Complex Clinical Applications: Gene-specific silencing in cultured cells Hepatitis C Virus and HIV anti-LTR ribozymes in circulating CD4 or CD34 cells M1 RNA of RNase P targeting of key transcripts in soluble tumors (see graphic) Ribozymes: An RNA molecule that has the ability to catalyze the cleavage and formation of covalent bonds at specific sites.
26	Non-coding RNAs: Ribozymes Synthetic Ribozymes and Engineered Reaction Mechanisms: Phosphoester transfer and hydrolysis polynucleotide ligation and phosphorylation mononucleotide polymerization Self-capping RNA branching aminoacyl transfer Acyl transfer amide bond cleavage and formation Glycosidic bond formation peptide bond formation N- and S-Alkylation Porphyrin metallation Diels-Alder reaction Oxidative DNA cleavage Aldol reaction Claisen condensation Redox reaction And more…
27	Non-coding RNA: RNA-mediated interference (RNAi)
28	Other types of non-con-coding RNAs: Small Inhibitory-RNA (miRNA & RNAi) Animations of Inhibitory RNA Action: Nature Reviews – A high quality movie describing inhibitory RNA events and mechanisms. NOVA ScienceNOW – RNAi video and related RNAi information Sources and Databases for RNAi Information: RNAi resources at NCBI, a subset of Probe db (more on next slide) RNAi Codex (CSHL) The RNAi Consortium (TRC) RNAi Resource (from Ambion) RNAi@Elegansnet RNAi database – infornation about RNAi studies in C. elegans Programs for RNAi Design: Whitehead Algorithm EMBOSS Algorithm And many, many others....
29	Non-coding RNAs: RNAi @ NCBI Sources and Databases for RNAi Information: RNAi portal at NCBI – offers links to relevant RNAi information such as: a glossary, review articles, projects, links to online probe design tools, and company links. Searches performed from that page are restricted to probes (below) whose application is gene silencing. NCBI Probe database – public registry of nucleic acid reagents designed for use in a wide variety of biomedical research applications, together with information on reagent distributors, probe effectiveness, and computed sequence similarities. Probe Query Tips
30	User Questions: Find RNAi reagents User Question: Find known RNAi reagents for a specific gene. Examples: I’d like to find out what RNAi reagents are available for the human gene GRPR (gastrin releasing peptide receptor). Answer
31	RNA Modification
32	RNA Modification RNA editing - The posttranscriptional mechanism that alters the nucleotide sequence of RNA. Editing involves, for example, insertion/deletion editing substitution editing addition editing modification editing, such as methylation editing. RNA modifications are found in all types of RNA. ~100 different post-transcriptionally modified nucleosides from RNA are presently known. The largest number (80%) with the greatest structural diversity are found in tRNA. Experimental Determination Methods: Enzyme Assays, Transcriptional Runoff Assays, TLC, HPLC, MS/MS Modification Databases: RNA Modification Database - Naturally modified nucleosides in RNA. RNA Editing Web Site
33	RNA Modifications
34	User Question: RNA Modifications User Question: Find RNA modification information Are there any post-transcriptional modifications of 5S rRNA in Eukarya? Answer
35	RNA Structural Analysis
36	RNA Structure
37	RNA base pairs and secondary structure elements The non-canonical base pair database RNA basepair isostericity The base pair directory
38	RNA structure
39	RNA Structural Analysis Experimental Determination Methods: Chemical reagent probing and primer extension analysis Nuclease Digestions and MS/MS or PAGE NMR or X-ray diffraction for 3D assessments Some computational prediction/analysis projects: 2D Structure prediction 3D visualization for assessment of motifs and interactions Comparative sequence analysis (Comparative RNA Web Site) Computational modeling for conformation and molecular motion/flexibility, as well as intra- and intermolecular associations
40	Secondary structure prediction RNA structure energetics: the lowest free energy structure is the most likely structure at equilibrium The number of GC versus AU and GU base pairs. Length of stem region? Number of base pairs in a hairpin loop region (loops with >10 or <5 bases requires more energy) Number of unpaired bases (interior loops or bulges). Web tools: RNA mfold web server RNAView Secondary Structure Viewer Vienna RNA Secondary Structure Prediction Alifold – web interface for predicting consensus structures of aligned sequences SFold Server DINAMelt RNAstructure – MS-Windows implementation of the Turner-Zuker algorithm for RNA folding Programs from Sean Eddy (all involve source code downloading) COVE (RNA structure analysis using covariance models) RNABOB (Pattern searching for RNA secondary structures) PKNOTs (RNA pseudoknot prediction) RNAdraw - an integrated program for RNA secondary structure calculation and analysis Non-canonical base pair database - Non-standard base-base interactions in known RNA structures. Michael Zuker's RNA page What is bracket notation?
41	User Question: Predicting RNA Structures User Question: Predict 2D structure for an RNA sequence. Use mfold to determine the secondary structure of the following strand of RNA: GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUU Answer
42	Structural databases and resources Repositories of 3D RNA structures: RNABase – RNA-based structures from both NDB and RCSB NDB – Nucleic Acid Database (Rutgers U.) RCSB – Generic structural database (Rutgers U.) MMDB – at NCBI's Structure group Structural Classification of RNA Database (SCOR) – a survey of the three-dimensional motifs, currently internal and external loops, found in a comprehensive collection of NMR and X-ray RNA structures Visualization and Analysis of 3D Structure: Cn3D – structure viewing application from NCBI Base Pair Viewer – view base pairs using the BPView program World Index of Molecular Visualization Resources – a repository of links to tutorials, demos, structural databases, galleries of images and visualization programs Mc-Sym – 2D/3D Molecular modeling using constraint satisfaction
43	User Questions: Using RNA Structures User Question: Determine base pairing interactions from structure files Use Base Pair Viewer to determine base pairs in a structure. Try Base Pair Viewer with the following files: 1J5E.pdb: Structure of the Thermus thermophilus 30S Ribosomal Subunit Wimberly BT, Brodersen DE, Clemons WM Jr, Morgan-Warren RJ, Carter AP, Vonrhein C, Hartsch T, Ramakrishnan V. Structure of the 30S ribosomal subunit. Nature. 2000 Sep 21;407(6802):327-39. (PMID: 11014182) 1DUL.pdb: Crystal structure of the ribonucleoprotein core of the signal recognition particle Batey RT, Rambo RP, Lucast L, Rha B, Doudna JA. Crystal structure of the ribonucleoprotein core of the signal recognition particle. Science. 2000 Feb 18;287(5456):1232-9. (PMID: 10678824) Answer
44	A few RNA sites to remember Comparative RNA Web Site – Information for 5S, 16S, 23S, GrpI, GrpII, and tRNA, including Comparative Structure Models (CSM). Nucleotide Frequency and Conservation Information. Sequence and Structure Data. Data Access Systems. RNA Structure Analysis. Motifs Analysis. RNA Folding. Phylogenetic Structure Analysis. Predicting RNA Structure with Comparative Analysis (Methods). This page requires a free one-time registration (Username and Password). The RNA World – Internet links on RNA related topics, including WebTools and Software. Michael Zuker's RNA page – Great links to RNA structural information RNABase – The RNA Structure Database. World Index of Molecular Visualization Resources – Internet links to structural tutorials, demos, databases, galleries of images and visualization programs (not RNA specific). The RNA Webring The RNA Society Good Places for Journal References: Nucleic Acids Research database issue Database Category: RNA Sequences RNA – The journal.
45	References The references associated with this module on “RNA Resources” are accessible from the link above and also from the modules page of the course web site.