NCBI logo
Molecular Biology Review module of the MLA course on Introduction to Molecular Biology Information Resources
Course Home Modules Schedule Exercises Comments Credits
Slide 1 Previous Next Slide List

ORF Finder - Hands On

Try using NCBI's ORF Finder to translate the following nucleotide sequence into protein:

cggagagtcagaagcaggagctgcgcgaggtccaccagtggatgcagacgggcggcctgcccgcagccatcgacgtggca gaat gtgtttactgtgaaaacaaggaaaaaggtaatatttgcataccatatgaggaagatattccttctctgggactcagcgaa gtgt cggacaccaaagaagacgaaaatggatcccccttgaatcacaggatcgaagagcagacgtaacccctgcccc

The sequence above is an excerpt from the Homo sapiens period homolog 2 (Drosophila) (PER2), transcript variant 1, mRNA (NM_022817.1)


Molecular Biology Review
Slide 1 Previous Next Slide List
Revised 11/01/2007