Go back to the original SWISS-PROT entry at NCBI. Now use the BLink link to retrieve related proteins, Click the Best Hits button and find the related protein from the fish Fundulus heteroclitus. Follow the PubMed link from this record to read about the biology of this protein. What is the physiological role of this CFTR homologue in this animal?

CFTR contains conserved domains that are homologous to bacterial transporters. These bacterial homologues do not appear in the BLink output because only the top 200 proteins are shown. You can use the "Related sequences" link on the CFTR_HUMAN record to find these. Go back to the CFTR_HUMAN record and follow the "Related sequences" link. How many related proteins are there? To identify the ones from bacteria click on the History tab. Follow the instructions on that page for constructing an query combining the protein neighbors with an organism field search bacteria. Your query will be something similar to the following

#13 AND bacteria[Organism]

Find the genomic scaffold AE003584 from Drosophila melanogaster using Entrez Nucleotide. Display protein links to see the predicted proteins for this scaffold. (You will need to increase the number of records displayed to see all of the proteins on one page. Then use the browser's "Find in page" function to find the protein that you want.) Identify conserved domains present in predicted protein CG10879 (AAF51293) by clicking on the BLink link and then clicking the CDD buttton. These conserved domains suggest a potential function for this hypothetical protein. Now perform a search against the Prosite patterns using the ScanProsite tool at ExPASy. Did you find the same protein family signature? To verify the Pfam results, try the search against the ProSite profiles. Do your results agree now? This points out the problems with representing a profile as a pattern.

The Entrez nucleotides [Properties] field stores information about the kind of sequence and its source. You can use the the index feature on the Preview/Index tab to display the terms that are indexed for this field. The Properties field terms are somewhat cryptic, but they are very useful for searching. Three useful types are the biomol, gbdiv and srcdb sets. The biomol terms classify records based on the the type and origin of the molecule, for example biomol mrna or biomol genomic. The gbdiv sets of terms index records by the GenBank division code, gbdiv est, gbdiv pri, gbdiv htg and so on. The srcdb terms classify records based upon their database origin. For nucleotide records these could be GenBank, EMBL, DDBJ, RefSeq or PDB (gbdiv genbank, gbdiv embl, gbdiv ddbj, gbdiv refseq). Perform an organism search for mouse, then use Preview/Index tab and the Properties field terms to count the number of mouse genomic records. How many of these are draft sequences (gbdiv htg)? How many are finished records (gbdiv rod)? How many are genome survey sequences? How many of these genomic records are RefSeqs? What kind of RefSeqs are they? Now retrieve all mouse mRNA records. How many of these are in the rodent division? How many are in the EST division? Using these properties field terms, design a query and retrieve all the mouse known mRNA RefSeqs (NM_).

Use Entrez Nucleotide to find the full-length cDNA (mRNA) sequence for Plasmodium falciparum glyceraldehyde 3-phosphate dehydrogenase (GAPD). This time start by typing Plasmodium in the search box without limiting to any field. How many records do you retrieve? Browse through your results to find some records that are not from Plasmodium. Display a few of these to see why you retrieved them; you should find "Plasmodium" somewhere on the record. Now use the Limits tab to restrict to Plasmodium in the Organism field [Organism]. How many nucleotide records in Entrez are from Plasmodium? Now find GAPD records by using the Preview/Index tab to add glyceraldehyde 3-phosphate dehydrogenase as a [Title] Word. How many records did you retrieve?

Search for population and phylogenetic studies on bears in Entrez PopSet. Find the study on brown bears and polar bears and display the alignment. What gene or molecular regions were used in this study? Use the tool bar link to display variations in the alignment. Are there fixed differences in the sequences from the brown bear, Ursus arctos, and the polar bear sequences in the alignment? What if the Ursus arctos sequence from the "ABC" islands (Sequence 7) is removed? Link to the article to read more about these remarkable results.

Substantial data are available for two species of filarial nematodes that are human parasites. Use the Taxonomy Browser to examine the number of nucleotide sequences for the superfamily Filaroidea and determine which two species these are. How many nucleotide and protein sequences are there for each of these two species? Display nucleotide records for each of these. What kinds of sequences are most of these?

Inositol polyphosphate phosphatases contain conserved acidic residues involved in binding metal ions. Retrieve the human INPP1 protein (INPP_HUMAN) from Entrez proteins. Follow the "Domains" link to to display pre-computed Conserved Domain Database (CDD) search results. Click on the "Details" button to display the complete results. Follow the link to the pfam inositol_P domain and display the domain in Cn3D by clicking on the "View 3D Structure" button. Identify the conserved residues surrounding the magnesium ions by double clicking on them in the structure. The corresponding residues will be highlighted in the sequence alignment. You can annotate the side chains on these if you like. First change the setting on the CDD page from "Virtual Bonds" to "All Atoms" then display the structure. You can then use the Style->Edit Global Style menu to turn off side chains and the Style->Annotate menu to selectively turn on the side chains for amino acids that coordinate the magnesium ions.

Leptin, the product of the obese gene, is a four-helix-bundle cytokine. This relationship to the cytokines cannot be shown by sequence similarity, however. You can verify this by performing at least two iterations of a PSI-BLAST search with the mouse leptin precursor (accession P41160). Retrieve the mouse leptin precursor using Entrez Protein. Display related sequences and then display structure links from the display pull-down list. View this structure with Cn3D and verify the four-helix bundle. Go back to the Web browser and click on the protein chain graphic to display related structures. Confirm that these are four-helix-bundle cytokines. View the structural alignment between leptin and its structural neighbor, interluekin 6. Do this by checking the box next to 1IL6 and clicking the View 3D structure button. Notice that the aligned residues in the two proteins are not similar by standard protein scoring matrices. This is a classic example of apparently homologous proteins that have diverged beyond the sensitivity of sequence similarity approaches.

Michael Crichton's fantasy about cloning dinosaurs, Jurassic Park, contains a putative dinosaur DNA sequence. Use nucleotide-nucleotide BLAST against the default nucleotide database, nr, to identify the real source of the following sequence. Select, copy and paste it into the BLAST form window.

This is probably the most common use of nucleotide-nucleotide BLAST: sequence identification, establishing whether an exact match for a sequence is already present in the database.

>DinoDNA from JURASSIC PARK  p. 103 nt 1-1200
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG
TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG
CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA
AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG
ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT
CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT
GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG
CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA
CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG
ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA
ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC
GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG
CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG
CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT

The the proper use of the translating BLAST services is to look for similar proteins (identify potential homologueues) in other species.

>DinoDNA from THE LOST WORLD  p. 135
GAATTCCGGAAGCGAGCAAGAGATAAGTCCTGGCATCAGATACAGTTGGAGATAAGGACG
GACGTGTGGCAGCTCCCGCAGAGGATTCACTGGAAGTGCATTACCTATCCCATGGGAGCC
ATGGAGTTCGTGGCGCTGGGGGGGCCGGATGCGGGCTCCCCCACTCCGTTCCCTGATGAA
GCCGGAGCCTTCCTGGGGCTGGGGGGGGGCGAGAGGACGGAGGCGGGGGGGCTGCTGGCC
TCCTACCCCCCCTCAGGCCGCGTGTCCCTGGTGCCGTGGGCAGACACGGGTACTTTGGGG
ACCCCCCAGTGGGTGCCGCCCGCCACCCAAATGGAGCCCCCCCACTACCTGGAGCTGCTG
CAACCCCCCCGGGGCAGCCCCCCCCATCCCTCCTCCGGGCCCCTACTGCCACTCAGCAGC
GGGCCCCCACCCTGCGAGGCCCGTGAGTGCGTCATGGCCAGGAAGAACTGCGGAGCGACG
GCAACGCCGCTGTGGCGCCGGGACGGCACCGGGCATTACCTGTGCAACTGGGCCTCAGCC
TGCGGGCTCTACCACCGCCTCAACGGCCAGAACCGCCCGCTCATCCGCCCCAAAAAGCGC
CTGCTGGTGAGTAAGCGCGCAGGCACAGTGTGCAGCCACGAGCGTGAAAACTGCCAGACA
TCCACCACCACTCTGTGGCGTCGCAGCCCCATGGGGGACCCCGTCTGCAACAACATTCAC
GCCTGCGGCCTCTACTACAAACTGCACCAAGTGAACCGCCCCCTCACGATGCGCAAAGAC
GGAATCCAAACCCGAAACCGCAAAGTTTCCTCCAAGGGTAAAAAGCGGCGCCCCCCGGGG
GGGGGAAACCCCTCCGCCACCGCGGGAGGGGGCGCTCCTATGGGGGGAGGGGGGGACCCC
TCTATGCCCCCCCCGCCGCCCCCCCCGGCCGCCGCCCCCCCTCAAAGCGACGCTCTGTAC
GCTCTCGGCCCCGTGGTCCTTTCGGGCCATTTTCTGCCCTTTGGAAACTCCGGAGGGTTT
TTTGGGGGGGGGGCGGGGGGTTACACGGCCCCCCCGGGGCTGAGCCCGCAGATTTAAATA
ATAACTCTGACGTGGGCAAGTGGGCCTTGCTGAGAAGACAGTGTAACATAATAATTTGCA
CCTCGGCAATTGCAGAGGGTCGATCTCCACTTTGGACACAACAGGGCTACTCGGTAGGAC
CAGATAAGCACTTTGCTCCCTGGACTGAAAAAGAAAGGATTTATCTGTTTGCTTCTTGCT
GACAAATCCCTGTGAAAGGTAAAAGTCGGACACAGCAATCGATTATTTCTCGCCTGTGTG
AAATTACTGTGAATATTGTAAATATATATATATATATATATATATCTGTATAGAACAGCC
TCGGAGGCGGCATGGACCCAGCGTAGATCATGCTGGATTTGTACTGCCGGAATTC

The Caenorhabditis elegans gene SMA-4 is a member of the dwarfins gene family, also called the MAD family, which plays a role in transforming growth factor beta-mediated signal transduction. In this example we will attempt to find homologs for the SMA-4 protein (SMA4_CAEEL, Accession P45897) in vertebrate species. using protein-protein BLAST.

Of course, this protein already is in the Entrez Protein and BLAST databases. Remember that if the goal is to find a homolog in another species for a protein that is already present in the Entrez system, it is not necessary to perform a BLAST search; the precalculated similarities are already available through BLink. Verify this by following the BLink link from P45897 in Entrez Protein. Click the best hits button and find the best protein hit to chicken (Gallus gallus). The alignment between SMA-4 and the best chicken match is available by clicking on the linked BLAST score.

To simulate performing a BLAST search with a novel protein, we will use an Entrez query to remove all Caenorhabditis proteins from the BLAST database.

Link to the protein-protein blast page and enter the SMA-4 accession number (P45897) in the Search text area. We will search against the default, nr, database. In order to remove, the Caenorhabditis proteins from the nr database, enter the following Entrez search in the "Limit by Entrez query" box under the "Options" section of the form:

protein all[Filter] NOT Caenorhabditis[Organism]

On the formatting page, you can see that the CD-search has identified conserved domains in this protein. You can click on the graphic to see what these domains are and what their function is.

Click the format button to retrieve your BLAST results. Look at your BLAST graphical output and verify that the Entrez query eliminated the protein from the database; you should see no full-length matches. Now look at your descriptions and their e-values. In the non-significant e-values (> 1) there are two proteins from sheep (Ovis aries) labeled as MAD proteins (Smad4 and Smad7). These protein fragments are homologs of SMA-4, but we did not demonstrate that with this particular search. In the following exercise we will show using PSI-BLAST that these sheep proteins are significant matches to SMA-4. Be sure to retain your formatting page for these results or copy your request ID so you can format them for PSI-BLAST fo the next exercise.

Look at the BLAST output and find all chicken (Gallus gallus) proteins that are similar to SMA-4. (Use the Tax Blast link at the upper left of the graphic to help in finding the chicken proteins.) These should be the same proteins found by BLink previously.

Open a new browser window so you don't lose your results against the nr and run the same search again. Restrict the search to chicken proteins using the Entrez query option as you did before. This time use the query

Chicken[Organism]

The Sma-4 protien that we used previously belongs to a large family of proteins. (Jump back to the protein-protein search). Some members of this family are not readily identified in an ordinary blastp search, however, additional Sma-4 homologs can be found by using the more sensitive position-specific iterated BLAST (PSI-BLAST). Any protein-protein BLAST search on the NCBI web pages can be extended to a PSI-BLAST search simply by re-formating the results. Check the "Format for PSI-BLAST" box on the formatting page for the first search that you saved from the exercise above and click format.

The results are the same except that they are formatted differently. There is a line across the descriptions section of the results corresponding to the PSI-BLAST inclusion threshold of 0.005. Position-specific information from a multiple sequence alignment of the sequences above this line are used to generate a position-specific score matrix (PSSM) in the next iteration. Notice that one of the first proteins below this line is the Smad4 from the sheep (Ovis aries). What is the e-value of this hit?

Now click the "Run PSI-BLAST iteration 2" button. Note that the Formatting page is refreshed in its separate window, generating a new Request ID number. Click the "Format" button and the results of iteration 2 will load. Click on the "Skip to the first new sequence" link on the Iteration 2 results page. What is this sequence? What is its new expect value? Notice that there are now several new sequences above threshold. Some of them are not annotated as Sma/Mad homologs but are clearly significant hits. These new sequences will be used to construct a new PSSM for iteration 3 and so on. After a few more iterations no more sequences will be found; at this point the search is said to have converged.

The human fragile histidine triad protein (FHIT, Accession P49789) isstructurally related to galactose-1-phosphate uridylyltransferases. However, this relationship is not apparent in an ordinary BLAST search. Perform a protein-protein BLAST search against the SWISS-PROT database with P49789 and search your results for galactose-1-phosphate uridylyltransferases. Now use PSI-BLAST to verify the relationship between these two protein families.

A frequent use of nucleotide-nucleotide BLAST is to check oligonucleotides for hybridization or PCR. The goal most people have when doing this is to make sure that the primer will give a unique product from the target genome or cDNA population. Because BLAST is local and searches both strands, one can simply concatenate a pair of +/- strand primers and use them in a single search. Combine the following pair of candidate PCR primers in a nucleotide-nucleotide search against the default nucleotide database and identify the gene amplified.

F12 GTCAAGTGGCAACTCCGTCAG          

R8  TTGAGAGATGGATTGTTGCGC

Now try these modified primers. There is one mismatch in each near the middle.

F12_mod GTCAAGTGGCTACTCCGTCAG          

R8_mod  TTGAGAGATGTATTGTTGCGC 

Notice that the previous hits are completely missing. Now adjust the Word Size from 11 to 7 under the BLAST Advanced Options and try the search again. Do you find the original hits again? Are they still the among the best hits? Can you devise a modification in the search strategy that will make them the best hits again?

As the database grows, so does the number of chance occurrences of amino acid motifs that spell out words or people's names in single-letter amino acid codes. One such name motif is ELVIS. Find the number of occurrences of ELVIS in the protein nr. To get any hits at all, you will have to adjust several of the advanced BLAST parameters including the Expect value, Word size, and Score Matrix. Adjust some of these in the "Other advanced options" box. Options are entered in a command-line style. For example, typing

-e 10000

UniGene is the best NCBI resource to use to find out to what gene (or suspected gene) a particular database sequence belongs. This is especially true for ESTs where there may be no annotations on the sequence, but may also be important for other sequences where the annotation may be incomplete or obsolete. Database identifiers for UniGene searches may come from BLAST output or from microarray (hybridization) data. For example, mRNA that hybridized to the EST sequence with accession number BG618105 was highly expressed in a human liver tumor sample.

1. Retrieve the record from the nucleotide database using the accession number in the search box on the NCBI homepage. Display the record. Is there any annotation indicating what gene this is?

2. Now link to UniGene from the "Links" menu in the upper right. What is the name of this gene? Link to LocusLink from the UniGene cluster. What is the function of this protein?

3. Go back to UniGene. Look at the ESTs in this cluster. How many are there? Identify a pair of ESTs (a 5' and 3' read) that come from the same clone ID. You'll nedd to display all ESTs and scroll down to see these. Use BLAST 2 sequences to align these to the full length RefSeq mRNA from the LocusLink entry. Note the mismatches that are most likely due to sequencing errors in the ESTs.

4. Expression information is implied by the sources of the cDNA libraries in a particular cluster. NCBI also has linked tag counts from quantitative SAGE libraries to the UniGene clusters. Follow the "Gene to Tag" mapping link to see a "virtual Northern" display of the counts of reliable tags from this cluster in SAGE libraries. What library shows the highest relative expression of this gene?

5. On the LocusLink page use the main map viewer link (mv) in the "Map Information" section to display this gene in the MapViewer. What chromosomal region is this? What maps are displayed? You can click on the map name at the top to learn more about the information displayed for each map. Uncheck the "Compress Maps" option on the left-hand-side to see the full marker labels. The UniGene map shows the density of EST hits on the genome. Generally the peaks in this histogram highlight the exons of expressed genes. Notice that there are some hits that don't correspond to the exons shown in the gene model on the Genes map. What could these represent? To see another view of the alignment based gene model follow the "ev" link to display this in the evidence viewer.

6. Use the the zoom graphic on the left hand side of the map viewer to zoom out and display two other members of this small gene family, AFP and AFM. Are these in the same orientation? There is also fourth member of this small family somewhat removed from these also on chromosome 4 called GC. Display the entire region between GC and AFM by typing these symbols in the "Region Shown" boxes on the left-hand-side and pressing the "Go" button.

7. From the LocusLink entry, click on the mouse gene symbol entry under mapping information to display the corresponding mouse LocusLink record. Follow the mouse map viewer link to display the corresponding region in the mouse map viewer. What chromosome is this? Adjust the view to see if the same gene family is present with the same structure in the mouse genome. Link to the contig record for this region of mouse genome from the map viewer. How large is this contig? Examine the bottom of the record and notice that it is assembled from both BAC clone (draft and finished) and whole genome shotgun sequence. Retrieve one of the whole genome shotgun pieces (e.g. CAAA01153721). Link from this record to the master record for the mouse whole genome shotgun project (CAAA01000000). How many records are in this set?

The gene causing the juvenile form of nephronophthisis was recently identified on human chromosome 1. We will use related protein and nucleotide records to identify this gene in other species. Retrieve the human NPHP4 entry from LocusLink. This protein apparently has a homolog in C. elegans. Demonstrate this by following the BLink link (BL) next to the provisional RefSeq protein in this entry. Clicking the "Best hits" button will make it easier to identify. Notice that there is also a homolog in mouse. Retrieve the mouse protein by linking through the Accession number. Display the linked nucleotide sequence. Use this Accession number (AY118229) in rat genome BLAST to find the gene in the rat genome. Search against the genome assembly. What supercontig did you hit? On what rat chromosome is this gene? Display your results in the Map Viewer by clicking on the Genome View button that appears on the BLAST results page and link to the contig map element. Use the "Maps and Options" link and add the "Genes" map to the display. Is this gene annotated on the rat Map Viewer?

Your BLAST hits imply an exon-intron structure for this gene. How many exons do your BLAST hits imply? How large is this gene? You can make a more precise alignment-based model for this gene using the Spidey tool. To do this you will need to adjust the base pair range displayed on the Map Viewer to the smallest interval that contains all of the BLAST hits. Then get this sequence using the "Download/View Sequence/Evidence" link. Display the genomic region in the browser and save it to disk. Use this genomic sequence on the Spidey page. Use the mouse cDNA (AY118229) you used before for the mRNA sequence.

The following amplified DNA sequence is associated with a human disease gene polymorphism:

TGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGAAC
ATCACCATGAAGTGGCTGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGAC
CTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTACCAGGTGGAGCACCCAGGCCTGGATCAGC
CCCTCATTGTGATCTGGG

We can now see if this polymorphism has been mapped to the genome from the SNP database. Use the "Maps and Options" link to add the Variation map to the display. To zoom in to the region by placethe mouse pointer over the map and click to display the pop-up zoom menu. Choose an appropriate level to see the polymorphisms in the region of interest. Find the coding region SNP that maps to the same place as your polymorphism identified by BLAST. Link from the Map Viewer to the RefSNP record. Does this SNP imply a change in the amino acid sequence? What is it? (You will notice that there are multiple splice variants for this gene, but the amino acid change is consistent in all of those that contain this coding exon.)

This is a well known polymorphism in the HFE gene that causes hemochromatosis when homozygous. From the RefSNP record you can link to OMIM to learn more about this. You can also follow the links to 3D structure mappings to display the position of this polymorphism in the structure (1A6Z) of the HFE protein. Based on this, why does this amino acid change have a detrimental effect on the function of this protein?

Try finding the mouse homologue of HFE by performing a BLAST search on the mouse genome page with the above human sequence fragnent. First do this with the Megablast box checked. Do you find any hits? Now try it with the Megablast off. Do you find it now?

Use LocusLink to find the the entry for the human glyceraldehyde 3-phosphate dehydrogenase gene. Click on the Map Viewer link ( mv) to find the map location and the contig containing the the GAPD gene. Zoom in to see the exon-intron structure of the gene. How many exons are there? Now use human genome BLAST to verify the location and structure of this gene. Use the GAPD RefSeq (NM_002046) to perform this search. Set both the alignments and descriptions to 250. How many contigs do you hit in the human genome? Click on the Genome View button to see the distribution of these hits on the genome. Look at some of the high scoring single hits and to see what's unusual about them. How can you account for these results?